Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_102032 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Primary Hepatic Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
DBLink | Link to database | PMID | 29609527 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 4 perioperative liver transplantation tissue and 4 normal control |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GATAAGGTAACAAGTCGATGGAT ReverseTGGAACTCTCTCTGGGGTGA | Statistics | Fold Change : Upregulated pvalue : p=6.92E-05 |
Citation | |||
Sui, W, Gan, Q, Liu, F, Chen, H, Liu, J, Dai, Y (2018). The differentially expressed circular ribonucleic acids of primary hepatic carcinoma following liver transplantation as new diagnostic biomarkers for primary hepatic carcinoma. Tumour Biol., 40, 4:1010428318766928. |